ID: 1182298079_1182298081

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1182298079 1182298081
Species Human (GRCh38) Human (GRCh38)
Location 22:29321687-29321709 22:29321740-29321762
Sequence CCATGAGTCCAAACTGATATAAA CATTCAGCTTGCTTGCTCCCAGG
Strand - +
Off-target summary {0: 3, 1: 55, 2: 186, 3: 378, 4: 662} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!