ID: 1182553929_1182553931

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1182553929 1182553931
Species Human (GRCh38) Human (GRCh38)
Location 22:31118616-31118638 22:31118632-31118654
Sequence CCAGAATTGCATGATCCAGGGTC CAGGGTCAGAATTCAGTCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 38, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!