ID: 1182584186_1182584191

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1182584186 1182584191
Species Human (GRCh38) Human (GRCh38)
Location 22:31334342-31334364 22:31334363-31334385
Sequence CCTTCACTACTACTTCCCTGCTT TTTCACAGCAGGTGTCCTGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!