ID: 1182586288_1182586300

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1182586288 1182586300
Species Human (GRCh38) Human (GRCh38)
Location 22:31345976-31345998 22:31346023-31346045
Sequence CCAAGAAGGGCACGCGCACGCGG GCAGGCGCGCGCGCGCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 46} {0: 1, 1: 0, 2: 5, 3: 45, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!