ID: 1182690968_1182690974

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1182690968 1182690974
Species Human (GRCh38) Human (GRCh38)
Location 22:32162302-32162324 22:32162325-32162347
Sequence CCACAAAAGAGACCATAAAAGGG GCCACAGGGAGTGTTATCACAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 9, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!