ID: 1182690968_1182690977

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1182690968 1182690977
Species Human (GRCh38) Human (GRCh38)
Location 22:32162302-32162324 22:32162335-32162357
Sequence CCACAAAAGAGACCATAAAAGGG GTGTTATCACAGGAGGAAAACGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 36, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!