|
Left Crispr |
Right Crispr |
Crispr ID |
1182842069 |
1182842074 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
22:33399179-33399201
|
22:33399219-33399241
|
Sequence |
CCCTGTGTCCATGTGTTCTCATT |
GAGTGAGAACAGGTGGTACTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 5602, 1: 7567, 2: 4903, 3: 2277, 4: 1416} |
{0: 1, 1: 8, 2: 444, 3: 7453, 4: 15632} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|