ID: 1182842069_1182842074

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1182842069 1182842074
Species Human (GRCh38) Human (GRCh38)
Location 22:33399179-33399201 22:33399219-33399241
Sequence CCCTGTGTCCATGTGTTCTCATT GAGTGAGAACAGGTGGTACTTGG
Strand - +
Off-target summary {0: 5602, 1: 7567, 2: 4903, 3: 2277, 4: 1416} {0: 1, 1: 8, 2: 444, 3: 7453, 4: 15632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!