ID: 1182842070_1182842074

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1182842070 1182842074
Species Human (GRCh38) Human (GRCh38)
Location 22:33399180-33399202 22:33399219-33399241
Sequence CCTGTGTCCATGTGTTCTCATTG GAGTGAGAACAGGTGGTACTTGG
Strand - +
Off-target summary {0: 14827, 1: 17946, 2: 7623, 3: 2542, 4: 1114} {0: 1, 1: 8, 2: 444, 3: 7453, 4: 15632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!