ID: 1182842071_1182842072

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1182842071 1182842072
Species Human (GRCh38) Human (GRCh38)
Location 22:33399187-33399209 22:33399209-33399231
Sequence CCATGTGTTCTCATTGTTCAACT TCTCACTTACGAGTGAGAACAGG
Strand - +
Off-target summary {0: 4620, 1: 15151, 2: 16808, 3: 7907, 4: 6951} {0: 2, 1: 4, 2: 67, 3: 229, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!