ID: 1183135412_1183135418

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1183135412 1183135418
Species Human (GRCh38) Human (GRCh38)
Location 22:35882363-35882385 22:35882392-35882414
Sequence CCCTTTCAGTGGTGTGGTTGCAA CCTGGCTGCGTGGGTTTAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!