ID: 1183183576_1183183584

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1183183576 1183183584
Species Human (GRCh38) Human (GRCh38)
Location 22:36278190-36278212 22:36278243-36278265
Sequence CCGGCCACTAGCAGTGTCTCATG AAAATTGGGCCCTGAGTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 508} {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!