ID: 1183183578_1183183581

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1183183578 1183183581
Species Human (GRCh38) Human (GRCh38)
Location 22:36278194-36278216 22:36278228-36278250
Sequence CCACTAGCAGTGTCTCATGGACA CTTTCCTCATATGGAAAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 9, 4: 114} {0: 1, 1: 0, 2: 14, 3: 149, 4: 1059}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!