ID: 1183293798_1183293802

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1183293798 1183293802
Species Human (GRCh38) Human (GRCh38)
Location 22:37018614-37018636 22:37018632-37018654
Sequence CCTGGTGAGTACCAGGACGCGTC GCGTCCAGCACCCGCAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33} {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!