ID: 1183529809_1183529820

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1183529809 1183529820
Species Human (GRCh38) Human (GRCh38)
Location 22:38347295-38347317 22:38347318-38347340
Sequence CCCGGCACTCCCAGGAGGTGACA GGTGGCCACAGGAGTGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 255} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!