ID: 1183823950_1183823963

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1183823950 1183823963
Species Human (GRCh38) Human (GRCh38)
Location 22:40370573-40370595 22:40370617-40370639
Sequence CCGCCCATGCCACGCCCCGCCAC AGCGCTGACTGGGTGCGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 540} {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!