ID: 1183823956_1183823959

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1183823956 1183823959
Species Human (GRCh38) Human (GRCh38)
Location 22:40370588-40370610 22:40370606-40370628
Sequence CCCGCCACGCGTGCGCTTAGGCG AGGCGCCGCTGAGCGCTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24} {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!