ID: 1183823961_1183823965

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1183823961 1183823965
Species Human (GRCh38) Human (GRCh38)
Location 22:40370611-40370633 22:40370638-40370660
Sequence CCGCTGAGCGCTGACTGGGTGCG GGGAAGCTGCTAACCCGACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88} {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!