ID: 1183859736_1183859742

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1183859736 1183859742
Species Human (GRCh38) Human (GRCh38)
Location 22:40661257-40661279 22:40661309-40661331
Sequence CCTTGTTCCAGAAGTCCTGGAAG ACCCTGCAATTCCACAAGTACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!