ID: 1183932645_1183932653

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1183932645 1183932653
Species Human (GRCh38) Human (GRCh38)
Location 22:41245162-41245184 22:41245203-41245225
Sequence CCTACGTGGCCGACTGCCAATGA GAAACCTTGGAGGGACTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28} {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!