ID: 1184100310_1184100319

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1184100310 1184100319
Species Human (GRCh38) Human (GRCh38)
Location 22:42338490-42338512 22:42338512-42338534
Sequence CCAATCCCGAAGAGCTCGCTCAG GGGGCTGCGAGTGGAAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42} {0: 1, 1: 0, 2: 5, 3: 58, 4: 617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!