ID: 1184105135_1184105141

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1184105135 1184105141
Species Human (GRCh38) Human (GRCh38)
Location 22:42363017-42363039 22:42363038-42363060
Sequence CCTGCCTCCTGGGCCCAGGACAC ACACTCATGCGGCTAATGCTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 76, 4: 510} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!