ID: 1184191633_1184191637

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1184191633 1184191637
Species Human (GRCh38) Human (GRCh38)
Location 22:42898855-42898877 22:42898873-42898895
Sequence CCCTGTGCAGAAACATCCGTGCA GTGCAATCAGGAGCAGAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!