ID: 1184199816_1184199822

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1184199816 1184199822
Species Human (GRCh38) Human (GRCh38)
Location 22:42960641-42960663 22:42960679-42960701
Sequence CCTTTGGATCCAGCACAAGAAAA CACCCTTCGAAGCCGGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 272} {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!