ID: 1184278091_1184278103

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1184278091 1184278103
Species Human (GRCh38) Human (GRCh38)
Location 22:43421719-43421741 22:43421769-43421791
Sequence CCTCCATCCATCCGTTTCTCCCT ACTGATGAAGTATTTGTGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 229, 4: 2827} {0: 1, 1: 0, 2: 2, 3: 18, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!