ID: 1184328759_1184328760

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1184328759 1184328760
Species Human (GRCh38) Human (GRCh38)
Location 22:43812252-43812274 22:43812271-43812293
Sequence CCATTCGGCGTCTCTAGGACGCT CGCTGTTGCCCGAGAGACGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17} {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!