ID: 1184465280_1184465289 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1184465280 | 1184465289 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 22:44665356-44665378 | 22:44665390-44665412 |
Sequence | CCAGCAACTGCCTCCATGGGTCA | GTGGGGGATGCCGTCCACCCAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |