ID: 1184540792_1184540798

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1184540792 1184540798
Species Human (GRCh38) Human (GRCh38)
Location 22:45122900-45122922 22:45122939-45122961
Sequence CCAATTAACCATATAGCCTATTG AACTAAAAGACAGGTGATCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!