ID: 1184740936_1184740942

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1184740936 1184740942
Species Human (GRCh38) Human (GRCh38)
Location 22:46428773-46428795 22:46428797-46428819
Sequence CCACCTCACTGCCTCACTGCACA CTCACTCACGGGTCCCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 465} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!