ID: 1184751326_1184751338

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1184751326 1184751338
Species Human (GRCh38) Human (GRCh38)
Location 22:46488108-46488130 22:46488149-46488171
Sequence CCTGCCCTGCACCTCAGTTTCAG GACAGCAGCTGGGTGACAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 36, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!