ID: 1184864064_1184864071

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1184864064 1184864071
Species Human (GRCh38) Human (GRCh38)
Location 22:47192797-47192819 22:47192815-47192837
Sequence CCGGACCAGTCCCCTGCATTCTA TTCTAATTGCCGGGACCCAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!