ID: 1184891200_1184891211

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1184891200 1184891211
Species Human (GRCh38) Human (GRCh38)
Location 22:47380489-47380511 22:47380534-47380556
Sequence CCAGGCGTGGTGGCCCATACCTG TGAGGCAGGCAGGTCACTTGAGG
Strand - +
Off-target summary {0: 7, 1: 782, 2: 21274, 3: 99378, 4: 211413} {0: 59, 1: 2382, 2: 10833, 3: 30969, 4: 60396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!