ID: 1184891200_1184891212

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1184891200 1184891212
Species Human (GRCh38) Human (GRCh38)
Location 22:47380489-47380511 22:47380539-47380561
Sequence CCAGGCGTGGTGGCCCATACCTG CAGGCAGGTCACTTGAGGCTAGG
Strand - +
Off-target summary {0: 7, 1: 782, 2: 21274, 3: 99378, 4: 211413} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!