ID: 1184891201_1184891210

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1184891201 1184891210
Species Human (GRCh38) Human (GRCh38)
Location 22:47380502-47380524 22:47380524-47380546
Sequence CCCATACCTGTAATTCCAGCACT TTTGGGAGGCTGAGGCAGGCAGG
Strand - +
Off-target summary No data {0: 375, 1: 1663, 2: 3864, 3: 6052, 4: 7673}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!