ID: 1184891202_1184891209

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1184891202 1184891209
Species Human (GRCh38) Human (GRCh38)
Location 22:47380503-47380525 22:47380520-47380542
Sequence CCATACCTGTAATTCCAGCACTT GCACTTTGGGAGGCTGAGGCAGG
Strand - +
Off-target summary No data {0: 59629, 1: 175979, 2: 229415, 3: 270535, 4: 297068}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!