ID: 1184919165_1184919170

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1184919165 1184919170
Species Human (GRCh38) Human (GRCh38)
Location 22:47593536-47593558 22:47593550-47593572
Sequence CCCTCCCCTCTCTGGCTCTTGCC GCTCTTGCCATGTGATGCACTGG
Strand - +
Off-target summary No data {0: 4, 1: 7, 2: 28, 3: 87, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!