ID: 1184956902_1184956907

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1184956902 1184956907
Species Human (GRCh38) Human (GRCh38)
Location 22:47894041-47894063 22:47894068-47894090
Sequence CCAGAGCTCCCACGGGATCAGCC CTTCCGATAGAACTGCATCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!