ID: 1185057376_1185057393

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1185057376 1185057393
Species Human (GRCh38) Human (GRCh38)
Location 22:48588020-48588042 22:48588067-48588089
Sequence CCTGCAGGTGCCAGGAGCCCCCT TGGGGGCTCCAGTGGTTTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 19, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!