ID: 1185057382_1185057392

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1185057382 1185057392
Species Human (GRCh38) Human (GRCh38)
Location 22:48588040-48588062 22:48588066-48588088
Sequence CCTTGGCCAAGCTCCATCTGTGC ATGGGGGCTCCAGTGGTTTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!