ID: 1185057383_1185057397

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1185057383 1185057397
Species Human (GRCh38) Human (GRCh38)
Location 22:48588046-48588068 22:48588079-48588101
Sequence CCAAGCTCCATCTGTGCATAATG TGGTTTGGGGGGTTGGTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125} {0: 1, 1: 0, 2: 1, 3: 25, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!