ID: 1185057388_1185057394

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1185057388 1185057394
Species Human (GRCh38) Human (GRCh38)
Location 22:48588053-48588075 22:48588068-48588090
Sequence CCATCTGTGCATAATGGGGGCTC GGGGGCTCCAGTGGTTTGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!