ID: 1185086644_1185086651

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1185086644 1185086651
Species Human (GRCh38) Human (GRCh38)
Location 22:48744451-48744473 22:48744469-48744491
Sequence CCTGGTGGCCCTCCCCAGGCCAT GCCATGACCCGTGTGGTTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 307} {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!