ID: 1185208382_1185208391

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1185208382 1185208391
Species Human (GRCh38) Human (GRCh38)
Location 22:49553196-49553218 22:49553210-49553232
Sequence CCTCGGGCACAGCCCTGTGGGCA CTGTGGGCAGGGAGGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 215} {0: 1, 1: 2, 2: 24, 3: 289, 4: 2030}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!