ID: 1185219320_1185219325

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1185219320 1185219325
Species Human (GRCh38) Human (GRCh38)
Location 22:49621672-49621694 22:49621686-49621708
Sequence CCCACAGCGGCCGGCCGACCACA CCGACCACACAGGTCAGCCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!