ID: 1185227255_1185227258

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1185227255 1185227258
Species Human (GRCh38) Human (GRCh38)
Location 22:49660136-49660158 22:49660156-49660178
Sequence CCTTGACGGGGAGAAACGCGGGG GGGCGCCACGCGGCACCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!