ID: 1185270430_1185270444

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1185270430 1185270444
Species Human (GRCh38) Human (GRCh38)
Location 22:49927065-49927087 22:49927117-49927139
Sequence CCGTCTGCCTCATCTCTCATCTG CCCTTGGATGGCTGCGTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 544} {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!