ID: 1185348263_1185348273

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1185348263 1185348273
Species Human (GRCh38) Human (GRCh38)
Location 22:50320026-50320048 22:50320057-50320079
Sequence CCCCATTCCCAGTGGGCCCTGCA TGGGCTGCCTGAAGCCTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 32, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!