ID: 1185362339_1185362343

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1185362339 1185362343
Species Human (GRCh38) Human (GRCh38)
Location 22:50415837-50415859 22:50415859-50415881
Sequence CCTGAAGACAGAGCTTACATACG GCACCATTAGGACAGAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77} {0: 1, 1: 0, 2: 2, 3: 12, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!