ID: 1185420089_1185420098

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1185420089 1185420098
Species Human (GRCh38) Human (GRCh38)
Location 22:50730378-50730400 22:50730418-50730440
Sequence CCATGCCCAGAGCCGGTGTCGGA AGCCCGCCCTTTGCCATGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!