ID: 1185466133_1185466143

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1185466133 1185466143
Species Human (GRCh38) Human (GRCh38)
Location X:355414-355436 X:355461-355483
Sequence CCAAGTTCATCTGGAGTCAACAG TGTCGTAGCAACGGAGGGACCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 0, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!