ID: 1185467113_1185467119

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1185467113 1185467119
Species Human (GRCh38) Human (GRCh38)
Location X:361729-361751 X:361758-361780
Sequence CCCTGCGGGGGACCACACACGTA TGCAGGGCCCACCTTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26} {0: 1, 1: 0, 2: 7, 3: 34, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!